новые химические технологии
АНАЛИТИЧЕСКИЙ ПОРТАЛ ХИМИЧЕСКОЙ ПРОМЫШЛЕННОСТИ
ПОИСК    

НА ГЛАВНУЮ 

СОДЕРЖАНИЕ:

НАУКА и ТЕХНОЛОГИИ

Базовая химия и нефтехимия

Продукты оргсинтеза ............

Альтернативные топлива, энергетика ...........................

Полимеры ...........................

ТЕНДЕНЦИИ РЫНКА

Мнения, оценки ...................

Законы и практика ...............

Отраслевая статистика .........

ЭКОЛОГИЯ

Промышленная безопасность

Экоиндустрия .......................

Рециклинг ............................

СОТРУДНИЧЕСТВО

Для авторов .........................

Реклама на сайте ................

Контакты .............................

Справочная .........................

Партнеры ............................

СОБЫТИЯ ОТРАСЛИ

Прошедшие мероприятия .....

Будущие мероприятия ...........

ТЕНДЕРЫ

ОБЗОРЫ РЫНКОВ

Исследование рынка дициандиамида в России
Исследование рынка куриных яиц в России
Исследование рынка сырого и питьевого молока в России
Исследование рынка программного обеспечения в России
Исследование рынка флотореагент-оксаля в России
Рынок триоктилтримелитата в России
Исследование рынка диоктилтерефталата в России
Исследование рынка диоктиладипината в России
Исследование рынка диоктилсебацината в России
Исследование рынка дибутилфталата в России

>> Все отчеты

ОТЧЕТЫ ПО ТЕМАМ

Базовая химия и нефтехимия
Продукты оргсинтеза
Синтетические смолы и ЛКМ
Нефтепереработка
Минеральные удобрения
Полимеры и синтетические каучуки
Продукция из пластмасс
Биохимия
Автохимия и автокосметика
Смежная продукция
Исследования «Ad Hoc»
Строительство
In English
  Экспорт статей (rss)

Продукты оргсинтеза

ПЕРСПЕКТИВЫ ИСПОЛЬЗОВАНИЯ ФУМАРОВОЙ КИСЛОТЫ В ФАРМАЦЕВТИКЕ

Пример 5

Получение резистентных к желудочному соку микротаблеток в капсулах, содержащих 120,0 мг диметилфумарата, соответственно, 96 мг фумаровой кислоты.12 кг Диметилфумарата размельчают и гомогенизируют как описано выше. Готовят смесь вспомогательных веществ следующего состава: 23,2 кг микрокристаллической целлюлозы (Avicel® PH 200), 3 кг натрийкроскармелозы (AC-Di-SOL-SD-711), 2,5 кг талька, 0,1 кг безводного диоксида кремния (Aerosil® 200) и 1 кг стеарата магния. Всю порошковую смесь смешивают с биологически активным веществом и перемешивают до гомогенности.

Порошковую смесь затем прессуют посредством прямого таблетирования с получением выпуклых таблеток брутто-массой 10,0 мг и диаметром 2,0 мм.

Затем готовят раствор 0,94 кг Eudragit® L в изопропаноле, который содержит дополнительно 0,07 кг дибутилфталата. Этот раствор наносят путем опрыскивания на ядра таблеток. После этого готовят дисперсию из 17,32 кг Eudragit® L D-55 и смеси из 2,8 кг микроталька, 2 кг макрогола 6000 и 0,07 кг диметикона в воде и наносят путем опрыскивания на ядра.

Резистентные к кислоте желудочного сока микротаблетки затем расфасовывают в разъемные твердые желатиновые капсулы нетто-массой по 650 мг и капсулы закрывают.

Пример 6

Транслокация NF-kappaB в клетки

NF-kappaB (p65) встраивали в вектор pEGFP-C1, который содержал EGFP (флуоресцирующий зеленым протеин), связанный с промотором цитомегаловируса (Clontech). Это приводит к экспрессии флуоресцирующего NF-kappaB. Между третьим и пятым пассажем производили посев клеток HUVEC в покрытые желатиной двенадцатилуночные культуральные планшеты (Costar) и оставляли расти до 80%-ной, соответственно, 90%-ной конфлюенции. Клетки затем трансфицировали по способу преципитации фосфатом кальция. Более конкретно, для этого клетки кондиционировали с помощью модифицированной по способу Дульбекко среды Игла (DMEM), спустя 2 часа добавляли содержащий 1 мкг ДНК на лунку преципитат и клетки инкубировали в течение следующих 4 часов. После промывки с помощью сбалансированного солевого раствора Хенкса (HBSS) добавляли культуральную среду и клетки, до их стимуляции, оставляли расти в течение следующих 18 часов.

Для опытов, клетки кондиционировали с помощью 40 мкмоль/л диметилфумарата (DMF), причем параллельные смеси без ДНК служили в качестве контроля. Спустя 2 часа после начала кондиционирования клетки стимулировали с помощью 10 нг/мл альфа-фактора некроза опухоли в указанные в таблице 1 периоды времени.

Клетки затем лизировали, супернатант отбрасывали и клеточные ядра аккумулировали в буфере Dounce с ингибиторами протеазы (10 ммоль трис-HCl, рН 7,6; 0,5 ммоль, MgCl2; 10 мкг/мл лейпептина, 10 мкг/мл апротинина, 1 ммоль фенилметилсульфонилфторида, 1,8 мг/мл иодацетамида). После центрифугирования в течение 10 минут при ускорении 1200 g и температуре 4°С клеточные ядра анализировали на сканирующем проточном клеточном цитометре с возбуждением флуоресценции (Becton Dickinson).

Таблица 1

Количество NF-kappaB(p65)-положительных ядер (данные в процентах относятся ко всем, трансфицированным с помощью NF-kappaB клеткам)
Продолжительность стимуляции Контроль DMF(40 мкМ/л, n=3)
0 мин 30+/-3 29+/-5
10 мин 61+/-5 20+/-4
30 мин 50+/-6 25+/-6
60 мин 55+/-10 24+/-9

Из таблицы видно, что диметилфумарат в концентрации 40 мкМ/л ингибирует индуцированную фактором некроза опухоли транслокацию NF-kappaB в клеточное ядро.

Пример 7

Ингибирование стимулированной NF-kappaB транскрипции

Трехкратный повтор консенсусного сайта АР-1 (место связывания) (48 пар оснований, 3 х TGTGATGACTCAGGTT) и трехкратный повтор консенсусного сайта NF-kappaB (60 пар оснований, 3 х AATCGTGGAATTTCCTCTGA), фланкированного местами связывания SpeI (не показано), встраивали в сайт SpeI вектора pTK-UBT-luc (Martin, Gene, 124, 137-138 (1993)). Конструкцию длиной 1,3 тысяч пар нуклеотидов Е-селектинового промотора протяженностью от -1285 пар оснований до +482 пар оснований встраивали в сайт NdeI вектора pMAM Neo-luc (Clontech).

Клетки HUVEC трансфицировали, как описано в примере 6, с помощью таким образом полученных конструкций. Для трансфекции на лунку добавляли 2,5 мкг соответствующей промоторной конструкции. Для проверки эффективности трансфекции в каждом эксперименте в качестве контроля осуществляли котрансфекции с помощью 500 нг контрольного вектора pSV-бета галактозидаза (Promega Corp., Madison, WI, США). Спустя 2 дня после трансфекции клетки стимулировали в течение 2 часов с помощью 10 нг/мл альфа-фактора некроза опухоли с добавкой и без добавки 6 мкг/мл диметилфумарата (DMF). Клетки затем собирали путем трипсинизации, центрифугировали, промывали и ресуспендировали в 200 мкл "репортерлизирующего буфера" (Promega) в течение 15 минут согласно инструкциям изготовителя.

Люциферазную активность определяли с помощью люминометра Berthold AutoLumat LB 9507 при использовании люциферазной тест-системы (Promega). Активность бета-галактозидазы определяли при использовании бета-галактозидазной ферментной системы фирмы Promega. Полученные с соответствующими промоторными конструкциями люциферазные активности стандартизировали до бета-галактозидазной активности. Ширина отклонений бета-галактозидазной активности в отдельных экспериментах составляла менее 10%. В таблице 2 представлены соответствующие результаты в виде х-кратных по отношению к базисной линии.

ФОРМУЛА ИЗОБРЕТЕНИЯ

1. Применение одного или нескольких диалкиловых эфиров фумаровой кислоты и моноалкиловых эфиров фумаровой кислоты в качестве специфического ингибитора транскрипции NF-kappaB-зависимого гена в фармацевтической композиции для лечения заболеваний, опосредованных NF-kappaB, выбранных из группы, включающей лечение прогрессирующей системной склеродермии, сифилитического остеохондрита (болезнь Вегера), Cutis marmorata (Livedo Reticularis), болезни Бехчета, панартериита, неспецифического язвенного колита, васкулита, остеоартрита, подагры, артериосклероза, синдрома Рейтера, бронхолегочного грануломатоза, типов энцефалита, эндотоксического шока (септически-токсический шок), сепсиса, пневмонии, энцефаломиелита, нервно-психической анорексии, Т-лимфоматоза Реннерта, мезангиального нефрита, постангиопластического рестеноза, цитомегаловирусной ретинопатии, аденовирусных заболеваний, как аденовирусные простудные заболевания, аденовирусная фарингоконъюнктивальная лихорадка и аденовирусная офтальмия, СПИДа, синдрома Гийена-Барре, постгерпетической невралгии или невралгии после опоясывающего лишая, воспалительной демиелинизирующей полиневропатии, множественных мононевропатий, муковисцидоза, болезни Бехтерева, язвы пищевода Бэррета, инфекции вирусом Эпстайна-Барра (EBV), кардиального ремоделирования, интерстициального цистита, сахарного диабета типа II, радиосенсибилизируемых злокачественных опухолей, частой резистентности злокачественных клеток к химиотерапевтическим средствам (резистентность ко многим лекарственным средствам в химиотерапии), кольцевидных гранулем и онкологических заболеваний, как рак молочной железы, рак ободочной кишки, меланома, первичная карцинома печеночных клеток, аденокарцинома, саркома Капоши, рак предстательной железы, лейкозы, как острый миелоидный лейкоз, множественная миелома (плазмоцитома), лимфома Беркитта и опухоль Кастлемана.

 

1 | 2 | 3 | 4
Версия для печати | Отправить |  Сделать стартовой |  Добавить в избранное
Статьи по теме
  • БЕНЗОЛ: технологии производства
  • САЙДИНГ ИЗ ФИБРОВОЛОКНА ЗАВОЕВЫВАЕТ РЫНОК
  • Порошковые покрытия: новые технологии (Часть 2)
  • МАЛЕИНОВЫЙ АНГИДРИД: области применения и прогноз спроса
  • БАНКРОТСТВА: «Камтекс-Химпром»
  • ФУМАРОВАЯ КИСЛОТА: применение в птицеводстве и свиноводстве
  • ПРИМЕНЕНИЕ ФУМАРОВОЙ КИСЛОТЫ
  • Куплю

    19.04.2011 Белорусские рубли в Москве  Москва

    18.04.2011 Индустриальные масла: И-8А, ИГНЕ-68, ИГНЕ-32, ИС-20, ИГС-68,И-5А, И-40А, И-50А, ИЛС-5, ИЛС-10, ИЛС-220(Мо), ИГП, ИТД  Москва

    04.04.2011 Куплю Биг-Бэги, МКР на переработку.  Москва

    Продам

    19.04.2011 Продаем скипидар  Нижний Новгород

    19.04.2011 Продаем растворители  Нижний Новгород

    19.04.2011 Продаем бочки новые и б/у.  Нижний Новгород

    Материалы раздела

    ФРУКТОЗА ВРЕДНЕЕ САХАРА
    ЗАЩИТА СОЕВЫХ ПОСЕВОВ
    ВОЗДЕЙСТВИЕ КОФЕИНА
    ПОЛИМОЧЕВИННЫЕ ПОКРЫТИЯ
    ПОКРЫТИЯ ДЛЯ СТАЛИ ПЯТОГО ПОКОЛЕНИЯ COLORCOAT PRISMA
    БУДУЩЕЕ ТРАНСГЕННЫХ ПРОДУКТОВ В РОССИИ
    КАК ЕДА МЕНЯЕТ ЧЕЛОВЕКА
    ПЕРВЫЕ ДОКЛИНИЧЕСКИЕ ИССЛЕДОВАНИЯ «КАРДИОНОВА»
    БОТОКС ПОМОГАЕТ от МИГРЕНИ
    МЕМБРАННЫЕ ЭЛЕМЕНТЫ LEWABRANE
    24 НОВЫХ АЛЛЕРГЕНА "АЛКОР БИО"
    МЕТОД РАННЕЙ ДИАГНОСТИКИ РАКА
    ПРОЕКТ TOPYIELD
    ПЕРВЫЙ РОССИЙСКИЙ ПРЕПАРАТ ДЛЯ ЛЕЧЕНИЯ ИШЕМИИ
    ДОСТИЖЕНИЯ BASF для ИНДУСТРИИ КРАСОТЫ
    СИНТЕЗ НОВЫХ БЕЛКОВ
    KEEP 32 СДЕЛАЕТ ЗУБЫ «НЕУЯЗВИМЫМИ ДЛЯ КАРИЕСА»
    ВИТАМИНЫ "КАВИКОРМ" для ЖИВОТНЫХ
    ВРЕДНО ЛИ ПАЛЬМОВОЕ МАСЛО?
    СВОЙСТВА И ПРИМЕНЕНИЕ ЛИЗИНА
    ПИЩЕВЫЕ ВОЛОКНА в ПРОИЗВОДСТВЕ ЗАМОРОЖЕННЫХ ПРОДУКТОВ
    ОТБЕЛИВАТЕЛИ «ПИГМЕНТА»
    МЕБЕЛЬНЫЙ ЛАК НА ОСНОВЕ РАСТИТЕЛЬНОГО СЫРЬЯ
    «МОСВОДОКАНАЛ»: гипохлорит натрия вместо хлора
    НОВЫЕ ПРОЕКТЫ: ДИОКСИД КРЕМНИЯ ИЗ РИСОВОЙ ШЕЛУХИ
    ФОЛИЕВАЯ КИСЛОТА - новое измерение в контрацепции
    «БИОКАД» об ИСПЫТАНИЯХ «АЛЬГЕРОНА»
    ВОЗМОЖНОСТИ ТОПИНАМБУРА
    ПИЩЕВЫЕ КРАСИТЕЛИ ДЛЯ ПАСХАЛЬНЫХ ЯИЦ
    НОВИНКИ BASF на «ИНТЕРПЛАСТИКА 2012»
    ВДЫХАЕМЫЕ ФОРМЫ ИНСУЛИНА
    БЕЗВРЕДЕН ЛИ ВИТАМИН Е?
    КОРМОВЫЕ ФЕРМЕНТЫ DIREVO
    ФРУКТОЗА - САМЫЙ ВРЕДНЫЙ САХАР
    НОВЫЕ АМИНОКИСЛОТЫ, НОВЫЕ БЕЛКИ
    БИОТЕСТЫ MAGNISENSE в РОССИИ
    ПРЕМИКСЫ YOUPIG ДЛЯ СВИНОВОДСТВА
    ОТЕЧЕСТВЕННАЯ «ЛЮКСОВАЯ» КОСМЕТИКА
    КРАХМАЛЬНЫЙ КЛЕЙ: адгезия и когезия
    «БИОКАД» о РАЗРАБОТКЕ БЕВАЦИЗУМАБА
    ОТЕЧЕСТВЕННЫЕ ФАРМИННОВАЦИИ
    НОВЫЕ ТЕХНОЛОГИИ ПОЧВООБРАБОТКИ
    АНТИМИКРОБНОЕ ВОЗДЕЙСТВИЕ НАФТАЛАНОВОЙ НЕФТИ
    ПРЕМИКСЫ NATUPHOS
    ПРОБИОТИКИ + ПРЕБИОТИКИ

    >>Все статьи

    Rambler's Top100 Рейтинг@Mail.ru
    Copyright © Newchemistry.ru 2006. All Rights Reserved